pucx multiple cloning site (Twist Bioscience)
Twist Bioscience is a verified supplier 
Twist Bioscience manufactures this product 
90
Structured Review
Twist Bioscience
pucx multiple cloning site
Pucx Multiple Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pucx+multiple+cloning+site/pucx+multiple+cloning+site/pmc10055417-184-30-19
Average 90 stars, based on 1 article reviews
Pucx Multiple Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pucx+multiple+cloning+site/pucx+multiple+cloning+site/pmc10055417-184-30-19
Average 90 stars, based on 1 article reviews
pucx multiple cloning site - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Cloning:Article Title: A metagenomic library cloning strategy that promotes high-level expression of captured genes to enable efficient functional screening Article Snippet: For replacement of the antibiotic resistance gene, the pUCX vector was amplified with forward primer CTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC and reverse primer ACTCTTCCTTTTTCAATATTATTGAAGC and assembled with a synthetic gentamycin cassette ordered from Twist Bioscience containing 5′ and 3′ 20-bp pUCX homology arms, using NEBuilder ® HiFi DNA Assembly (New England Biolabs). .. A synthetic cloning site comprising an NcoI recognition sequence flanked by XbaI and HindIII restriction sites was ordered from Twist Bioscience and used to replace the XbaI-HindIII region of the Sequencing:Article Title: A metagenomic library cloning strategy that promotes high-level expression of captured genes to enable efficient functional screening Article Snippet: For replacement of the antibiotic resistance gene, the pUCX vector was amplified with forward primer CTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAAC and reverse primer ACTCTTCCTTTTTCAATATTATTGAAGC and assembled with a synthetic gentamycin cassette ordered from Twist Bioscience containing 5′ and 3′ 20-bp pUCX homology arms, using NEBuilder ® HiFi DNA Assembly (New England Biolabs). .. A synthetic cloning site comprising an NcoI recognition sequence flanked by XbaI and HindIII restriction sites was ordered from Twist Bioscience and used to replace the XbaI-HindIII region of the |